Recombination: CO and NCO outcome. MER3/RCK. Zm00001d006382. MSH4.

50.10.10 DNA genome replication 50.10.20 DNA recombination 50.10.30 DNA repair 50.10.40

HRRm Homologous recombination repair gene mutations HRRwt Homologous recombination repair gene wild type Human epidermal growth factor receptor 2, mutated HNSCC Head and …

Right arm of the homologous recombination site NS1 (alr3858_D748-alr3858_D749) into the chromosome of Anabaena sp. PCC7120 - from GenBank: NC_003272 Left arm of the …

variable segment of immunoglobulin light and heavy chains, and T-cell receptor alpha, beta, and gamma chains; codes for most of the variable region (V_region) and the last few amino acids …

UUUAUUCAGGAAUCUUCGGGA Solyc11g017040.2.1 Peptidase C48 (AHRD V3.3 *** A0A200QIZ9_9MAGN) UCCAUUUAGGGAUUCCUUGGA Solyc08g081590.3.1 Meiotic …

putative antimicrobial activity.

PIS PITX2 Estelle Talouarn High and low recombination areas Rachel Rupp Y markers already selected by Hans Lenstra

FvH4_1g07720.1 FvH4_1g07730.1 ko03440 Homologous recombination FvH4_1g07740.1 FvH4_1g07750.1 FvH4_1g07790.1

Mar 30, 2017 · runt related transcription factor 2 ENSMUSG00000039191 Rbpj recombination signal binding protein for immunoglobulin kappa J region ENSMUSG00000039219 Arid4b AT …